About   Help   FAQ
D4Mit62 Primer Detail
Primers
  • Name
    D4Mit62
  • Primer 1 Sequence
    TCCTCTGCCAGCTCTCTCTG
  • Primer 2 Sequence
    CTGCAAGGAGGTGATGTTCA
  • ID
    MGI:706021
  • Product Size
    191
  • Note
    MIT assay: MPC675
Genes
D4Mit62 DNA segment, Chr 4, Massachusetts Institute of Technology 62
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit62 a 170bp AKR/J, NOD/MrkTac, NON/ShiLt
b 186bp DBA/2J
c 190bp A/J, B6.Cg-Lepob/+, C57BL/6J
d 210bp CAST/EiJ, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D4Mit62 a 190bp 129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
b 186bp BN/aW, DBA/2W
c 170bp AKR/W, C3H/W, CBA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory