About   Help   FAQ
D10Mit115 Primer Detail
Primers
  • Name
    D10Mit115
  • Primer 1 Sequence
    CCATGGAATAGAAGTCTTTAAGAAGC
  • Primer 2 Sequence
    ACCTGAAGGATAAAGGGTCTTACC
  • ID
    MGI:705999
  • Product Size
    126
  • Other IDs
    D10Mit115 (BROAD)
  • Note
    MIT assay: MT704
    Additional information: MIT STS Marker Data Files
Genes
D10Mit115 DNA segment, Chr 10, Massachusetts Institute of Technology 115
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D10Mit115 c 143bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit115 a 121bp C57BL/6J
b 127bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, DBA/2J, LP/J, NON/ShiLt
c 129bp NOD/MrkTac
d 140bp CAST/EiJ
e 143bp C3H/HeJ
f 152bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D10Mit115 a 143bp BN/aW, C3H/W, CBA/W
b 127bp 129/SvW, A.CA/W, AKR/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory