About   Help   FAQ
D2Mit346 Primer Detail
Primers
  • Name
    D2Mit346
  • Primer 1 Sequence
    CCTGCACATTGGATTGTGTT
  • Primer 2 Sequence
    TGAGTCTGGGCTGGAGTTG
  • ID
    MGI:705983
  • Product Size
    99
  • Other IDs
    D2Mit346 (BROAD)
  • Note
    MIT assay: MT4374
    Additional information: MIT STS Marker Data Files
Genes
D2Mit346 DNA segment, Chr 2, Massachusetts Institute of Technology 346
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit346 a 99bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
b 105bp NOD/MrkTac
c 111bp CAST/EiJ, SPRET/EiJ
d 116bp LP/J
e 131bp NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit346 c 206bp CBA/CaOlaHsd
s 187bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit346 a larger 129P3/J
s smaller SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory