About   Help   FAQ
D3Mit17 Primer Detail
Primers
  • Name
    D3Mit17
  • Primer 1 Sequence
    CATGGCTCCATGGTTCTTG
  • Primer 2 Sequence
    CCACGGAGAACAACTGAAGA
  • ID
    MGI:705976
  • Product Size
    198
  • Other IDs
    D3Mit17 (BROAD)
  • Note
    MIT assay: M235
    Additional information: MIT STS Marker Data Files
Genes
D3Mit17 DNA segment, Chr 3, Massachusetts Institute of Technology 17
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D3Mit17 b not given C57BL/6J
c 180bp C3HeB/FeJLe
f smallest FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit17 a 180bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NON/ShiLt
b 188bp LP/J
c 200bp CAST/EiJ
d 208bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory