About   Help   FAQ
D19Mit91 Primer Detail
Primers
  • Name
    D19Mit91
  • Primer 1 Sequence
    GGGTTGGCTCAATACTCCAA
  • Primer 2 Sequence
    CCCCCACCTGGTATCTTGAG
  • ID
    MGI:705967
  • Product Size
    109
  • Other IDs
    D19Mit91 (BROAD)
  • Note
    MIT assay: MT4012
    Additional information: MIT STS Marker Data Files
Genes
D19Mit91 DNA segment, Chr 19, Massachusetts Institute of Technology 91
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit91 a 90bp 129X1/Sv
f 94, 98bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit91 c 90bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit91 a 90bp C3H/HeJ, NOD/MrkTac
b 94bp CAST/EiJ
c 112bp B6.Cg-Lepob/+, C57BL/6J, SPRET/EiJ
d 132bp AKR/J, NON/ShiLt
e 134bp A/J, BALB/cJ, DBA/2J, LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit91 c 137bp CBA/CaOlaHsd
s 135bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit91 a larger 129P3/J
s smaller SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory