About   Help   FAQ
D13Mit3 Primer Detail
Primers
  • Name
    D13Mit3
  • Primer 1 Sequence
    TCAGGCTCATCCCAGATACC
  • Primer 2 Sequence
    TTTTGCAGAGAACACACACC
  • ID
    MGI:705960
  • Product Size
    162
  • Other IDs
    D13Mit3 (BROAD)
  • Note
    MIT assay: M79
    Additional information: MIT STS Marker Data Files
Genes
D13Mit3 DNA segment, Chr 13, Massachusetts Institute of Technology 3
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit3 a 196bp 129X1/Sv
f 164, 188bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D13Mit3 b smallest C57BL/6J
c 196bp C3HeB/FeJLe
f smaller FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit3 m 270bp MOLF/EiJ
s 173bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit3 a 159bp B6.Cg-Lepob/+, C57BL/6J
b 163bp LP/J
c 164bp AKR/J, NOD/MrkTac
d 178bp SPRET/EiJ
e 188bp A/J, BALB/cJ, NON/ShiLt
f 196bp C3H/HeJ, CAST/EiJ, DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D13Mit3 a 196bp C3H/W, C57BL/10W, CBA/W, DBA/2W
b 188bp A.CA/W, BALB/cW
c 164bp AKR/W
d 159bp BN/aW, C57BL/6W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D13Mit3 c larger CBA/Kw
e smaller KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory