D17Mit83 Primer Detail MGI Mouse MGI:705951

D17Mit83 Primer Detail

Name

D17Mit83
Primer 1 Sequence

GTTACAGTCTTTCTTAAGGTAATTGCG
Primer 2 Sequence

CAGTGCTGCTCCCAACATTA
ID

MGI:705951
Product Size

119
Other IDs

D17Mit83 (BROAD)
Note

MIT assay: D979
Additional information: MIT STS Marker Data Files

D17Mit83

DNA segment, Chr 17, Massachusetts Institute of Technology 83

J:23589 Vernet C, et al., Mamm Genome. 1995 Mar;6(3):219-21

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit83	c	smallest	C3H
notnot given	D17Mit83	a	larger	STOCK t¹²
		b	large	STOCK t^w5
		d	largest	STOCK t^w12

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit83	a	smallest	M. spretus
		b	larger	A.CA-H2^f/Sn
		c	larger than above	CAST/EiJ, CBA/J, DBA/2J
		d	larger than above	C57BL/6J
		e	larger than above	SWR/J
		f	larger than above	RIIIS/J, SJL/J
		g	larger than above	SM/J
		h	larger than above	P/J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit83	a	110bp	SPRET/EiJ
	b	130bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J
	c	133bp	LP/J
	d	134bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	135bp	NON/ShiLt
	f	146bp	NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit83	a	140bp	BN/aW
	b	134bp	129/SvW, C57BL/6W, C57BL/10W
	c	130bp	A.CA/W, AKR/W, BALB/cW, C3H/W, CBA/W, DBA/2W

J:23589 Vernet C, et al., Mapping of 12 markers in the proximal region of mouse chromosome 17 using recombinant t haplotypes. Mamm Genome. 1995 Mar;6(3):219-21

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23