About   Help   FAQ
D17Mit82 Primer Detail
Primers
  • Name
    D17Mit82
  • Primer 1 Sequence
    GACAAGGGGTCCTTGAATCA
  • Primer 2 Sequence
    AATAGCAGCGGATGGAACC
  • ID
    MGI:705950
  • Product Size
    136
  • Other IDs
    D17Mit82 (BROAD)
  • Note
    MIT assay: MPC2560
    Additional information: MIT STS Marker Data Files
Genes
D17Mit82 DNA segment, Chr 17, Massachusetts Institute of Technology 82
Polymorphisms
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit82 a smallest CAST/EiJ
b larger A.CA-H2f/Sn, C57BL/6J, CBA/J
c larger than above M. caroli
d larger than above SJL/J
e larger than above SWR/J
f larger than above DBA/2J
g larger than above SM/J
h larger than above P/J
i larger than above RIIIS/J
j larger than above M. spretus
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit82 a 128bp CAST/EiJ
b 138bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
References
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory