About   Help   FAQ
D9Mit18 Primer Detail
Primers
  • Name
    D9Mit18
  • Primer 1 Sequence
    TCACTGTAGCCCAGAGCAGT
  • Primer 2 Sequence
    CCTGTTGTCAACACCTGATG
  • ID
    MGI:705941
  • Product Size
    180
  • Other IDs
    D9Mit18 (BROAD)
  • Note
    MIT assay: M10
    Additional information: MIT STS Marker Data Files
Genes
D9Mit18 DNA segment, Chr 9, Massachusetts Institute of Technology 18
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D9Mit18 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit18 a 180bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, SPRET/EiJ
b 204bp AKR/J, DBA/2J, NON/ShiLt
c 210bp A/J, C3H/HeJ, CAST/EiJ
d 213bp BALB/cJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit18 l larger LG/J
s smaller SM/J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D9Mit18 c upper CBA/Kw
e lower KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory