About   Help   FAQ
D9Mit19 Primer Detail
Primers
  • Name
    D9Mit19
  • Primer 1 Sequence
    CCAAACACAACCCCTCAGAA
  • Primer 2 Sequence
    TCATGGCTTCAAGACTGCTT
  • ID
    MGI:705940
  • Product Size
    100
  • Other IDs
    D9Mit19 (BROAD)
  • Note
    MIT assay: M157
    Additional information: MIT STS Marker Data Files
Genes
D9Mit19 DNA segment, Chr 9, Massachusetts Institute of Technology 19
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit19 a 89bp AKR/J, DBA/2J, NON/ShiLt
b 92bp CAST/EiJ
c 102bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
d 108bp A/J, BALB/cJ, C3H/HeJ, SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit19 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D9Mit19 a 108bp A.CA/W, BALB/cW, BN/aW, C3H/W
b 102bp 129/SvW, C57BL/6W, C57BL/10W, CBA/W
c 89bp AKR/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory