D9Mit19 Primer Detail MGI Mouse MGI:705940

D9Mit19 Primer Detail

Name

D9Mit19
Primer 1 Sequence

CCAAACACAACCCCTCAGAA
Primer 2 Sequence

TCATGGCTTCAAGACTGCTT
ID

MGI:705940
Product Size

100
Other IDs

D9Mit19 (BROAD)
Note

MIT assay: M157
Additional information: MIT STS Marker Data Files

D9Mit19

DNA segment, Chr 9, Massachusetts Institute of Technology 19

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit19	a	89bp	AKR/J, DBA/2J, NON/ShiLt
	b	92bp	CAST/EiJ
	c	102bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac
	d	108bp	A/J, BALB/cJ, C3H/HeJ, SPRET/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit19	l	smaller	LG/J
	D9Mit19	s	larger	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D9Mit19	a	108bp	A.CA/W, BALB/cW, BN/aW, C3H/W
	b	102bp	129/SvW, C57BL/6W, C57BL/10W, CBA/W
	c	89bp	AKR/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23