About   Help   FAQ
D9Mit269 Primer Detail
Primers
  • Name
    D9Mit269
  • Primer 1 Sequence
    TTTTTGGACTAATAGTCAACTGTGTAA
  • Primer 2 Sequence
    AGGAAGACTGAAAACTTGTGGG
  • ID
    MGI:705934
  • Product Size
    172
  • Other IDs
    D9Mit269 (BROAD)
  • Note
    MIT assay: MT5025
    Additional information: MIT STS Marker Data Files
Genes
D9Mit269 DNA segment, Chr 9, Massachusetts Institute of Technology 269
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit269 a 130bp SPRET/EiJ
b 148bp A/J, BALB/cJ, C3H/HeJ, LP/J
c 166bp AKR/J, DBA/2J, NOD/MrkTac
d 172bp NON/ShiLt
e 176bp B6.Cg-Lepob/+, C57BL/6J
f 178bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D9Mit269 b 164bp C57BL/6JOlaHsd
c 138bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ
d 156bp AKR/OlaHsd, DBA/2J
j 190bp JF1
l 136bp SJL/J
p 182bp PWB
r 162bp C57BL/10
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D9Mit269 a 176bp C57BL/6W, C57BL/10W, CBA/W
b 166bp AKR/W, DBA/2W
c 148bp 129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory