About   Help   FAQ
D10Mit184 Primer Detail
Primers
  • Name
    D10Mit184
  • Primer 1 Sequence
    TACCACCACTGGCTTATAACTGG
  • Primer 2 Sequence
    GACACAAACATAAACTTCAGGCC
  • ID
    MGI:705894
  • Product Size
    128
  • Other IDs
    D10Mit184 (BROAD)
  • Note
    MIT assay: MT3255
    Additional information: MIT STS Marker Data Files
Genes
D10Mit184 DNA segment, Chr 10, Massachusetts Institute of Technology 184
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit184 a 132bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
b 134bp NON/ShiLt
c 136bp LP/J, SPRET/EiJ
d 142bp CAST/EiJ
J:53815 Vacher J, et al., Mamm Genome. 1999 Mar;10(3):239-43
Endonuclease Gene Allele Fragments Strains
D10Mit184 b 0.132kb C57BL/6J, C57BL/10J, C57BR/cdJ, C57L/J
g 0.134kb 129T2/SvEms, GL/Le Ostm1gl/Ostm1gl
m 0.15kb M. m. molossinus
s 0.137kb M. spretus
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit184 c 135bp CBA/CaOlaHsd
s 140bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:53815 Vacher J, et al., Genetic localization and transmission of the mouse osteopetrotic grey-lethal mutation. Mamm Genome. 1999 Mar;10(3):239-43
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory