About   Help   FAQ
D11Mit2 Primer Detail
Primers
  • Name
    D11Mit2
  • Primer 1 Sequence
    TCCCAGAGGTCTCCAAGACA
  • Primer 2 Sequence
    CCACAGTGTGTGATGTCTTC
  • ID
    MGI:705871
  • Product Size
    107
  • Other IDs
    D11Mit2 (BROAD)
  • Note
    MIT assay: L14
    Additional information: MIT STS Marker Data Files
Genes
D11Mit2 DNA segment, Chr 11, Massachusetts Institute of Technology 2
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit2 a 122bp 129X1/Sv
f 112, 122bp CD-1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit2 m 141bp MOLF/EiJ
s 116bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit2 a 109bp SPRET/EiJ
b 112bp A/J, BALB/cJ, LP/J, NON/ShiLt
c 116bp CAST/EiJ
d 122bp B6.Cg-Lepob/+, C57BL/6J
e 124bp DBA/2J
f 137bp AKR/J, C3H/HeJ, NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D11Mit2 b 107bp C57BL/6JOlaHsd, C57BL/10
c 99bp A/JOlaHsd, BALB/cJ
d 109bp 129P3/J, DBA/2J
j 131bp JF1
l 111bp SJL/J
p 125bp AKR/OlaHsd, C3H/HeJ, PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit2 l larger LG/J
s smaller SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory