D11Mit4 Primer Detail MGI Mouse MGI:705870

D11Mit4 Primer Detail

Name

D11Mit4
Primer 1 Sequence

CAGTGGGTCATCAGTACAGCA
Primer 2 Sequence

AAGCCAGCCCAGTCTTCATA
ID

MGI:705870
Product Size

249
Other IDs

D11Mit4 (BROAD)
Note

MIT assay: A124
Additional information: MIT STS Marker Data Files

D11Mit4

DNA segment, Chr 11, Massachusetts Institute of Technology 4

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit4	c	242bp	C3HeB/FeJLe
	D11Mit4	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit4	a	238bp	SPRET/EiJ
	b	242bp	BALB/cJ, C3H/HeJ, NON/ShiLt
	c	244bp	NOD/MrkTac
	d	246bp	C57BL/6J, CAST/EiJ
	e	250bp	B6.Cg-Lep^ob/+
	f	300bp	DBA/2J
	g	306bp	LP/J
	h	307bp	A/J, AKR/J

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D11Mit4	c	larger	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit4	l	smaller	LG/J
	D11Mit4	s	larger	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit4	c	145bp	CBA/CaOlaHsd
	D11Mit4	s	146bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit4	a	larger	129P3/J
	D11Mit4	s	smaller	SJL/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24