About   Help   FAQ
D11Mit8 Primer Detail
Primers
  • Name
    D11Mit8
  • Primer 1 Sequence
    CTTTTCATGGAGGCACAGGT
  • Primer 2 Sequence
    TGTGAACAGAGACACACATTCA
  • ID
    MGI:705867
  • Product Size
    154
  • Other IDs
    D11Mit8 (BROAD)
  • Note
    MIT assay: M212
    Additional information: MIT STS Marker Data Files
Genes
D11Mit8 DNA segment, Chr 11, Massachusetts Institute of Technology 8
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit8 a 133bp AKR/J, BALB/cJ
b 155bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 170bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit8 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D11Mit8 a 155bp 129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 133bp BALB/cW
c 130bp AKR/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory