D12Mit214 Primer Detail MGI Mouse MGI:705862

D12Mit214 Primer Detail

Name

D12Mit214
Primer 1 Sequence

TTCATGCTCCCAAAAGGG
Primer 2 Sequence

GCCAGTCTTTGAGATCAGGC
ID

MGI:705862
Product Size

147
Other IDs

D12Mit214 (BROAD)
Note

MIT assay: MT3634
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 214

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit214	a	146bp	BALB/cJ, C57BL/6J, LP/J
	b	148bp	B6.Cg-Lep^ob/+
	c	160bp	NOD/MrkTac, NON/ShiLt
	d	170bp	A/J, AKR/J, C3H/HeJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit214	a	170bp	A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
	D12Mit214	b	146bp	129/SvW, BALB/cW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24