About   Help   FAQ
D1Mit316 Primer Detail
Primers
  • Name
    D1Mit316
  • Primer 1 Sequence
    GCCTTTCCAGGTTTCTTAAGG
  • Primer 2 Sequence
    GGCTTCTGCAGGATATCTGC
  • ID
    MGI:705842
  • Product Size
    148
  • Other IDs
    D1Mit316 (BROAD)
  • Note
    MIT assay: MT109
    Additional information: MIT STS Marker Data Files
Genes
D1Mit316 DNA segment, Chr 1, Massachusetts Institute of Technology 316
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit316 a 122bp SPRET/EiJ
b 128bp CAST/EiJ
c 142bp C3H/HeJ
d 150bp A/J, AKR/J, BALB/cJ, C57BL/6J
e 151bp B6.Cg-Lepob/+
f 152bp DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit316 c 141bp CBA/CaOlaHsd
s 152bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/07/2024
MGI 6.23 		The Jackson Laboratory