About   Help   FAQ
D18Mit40 Primer Detail
Primers
  • Name
    D18Mit40
  • Primer 1 Sequence
    GGTAGGAGTCACTTTCCGTCC
  • Primer 2 Sequence
    TTTTGTGAGCATTTTTATACCATT
  • ID
    MGI:705836
  • Product Size
    140
  • Other IDs
    D18Mit40 (BROAD)
  • Note
    MIT assay: B561
    Additional information: MIT STS Marker Data Files
Genes
D18Mit40 DNA segment, Chr 18, Massachusetts Institute of Technology 40
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit40 a 132bp 129X1/Sv
f 136bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit40 a 132bp A/J, BALB/cJ, C3H/HeJ
b 142bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 158bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D18Mit40 c 130bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 140bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, JF1, SJL/J
g 134bp 129P3/J
p 158bp PWB
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory