About   Help   FAQ
D1Mit166 Primer Detail
Primers
  • Name
    D1Mit166
  • Primer 1 Sequence
    GATGAAGTGAAAATGATCCTTGC
  • Primer 2 Sequence
    TATCTTTTGTGGACTCGGGG
  • ID
    MGI:705825
  • Product Size
    121
  • Other IDs
    D1Mit166 (BROAD)
  • Note
    MIT assay: MT930
    Additional information: MIT STS Marker Data Files
Genes
D1Mit166 DNA segment, Chr 1, Massachusetts Institute of Technology 166
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit166 a 108bp AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
b 123bp A/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J
c 125bp CAST/EiJ
d 139bp SPRET/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit166 a smaller 129P3/J
s larger SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit166 a 123bp 129/SvW, A.CA/W, BN/aW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 108bp AKR/W, BALB/cW, C3H/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory