About   Help   FAQ
D10Mit36 Primer Detail
Primers
  • Name
    D10Mit36
  • Primer 1 Sequence
    GGCTTTGGGGATAGCATTG
  • Primer 2 Sequence
    AACATGCTGTCGAACAGAAGC
  • ID
    MGI:705793
  • Product Size
    144
  • Other IDs
    D10Mit36 (BROAD)
  • Note
    MIT assay: B317
    Additional information: MIT STS Marker Data Files
Genes
D10Mit36 DNA segment, Chr 10, Massachusetts Institute of Technology 36
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit36 a 138bp 129X1/Sv
f 142bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit36 a 138bp BALB/cJ, LP/J, NON/ShiLt
b 142bp CAST/EiJ
c 146bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
d 148bp DBA/2J
e 160bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit36 a 145bp A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, SJL/J
c 137bp 129P3/J, BALB/cJ
d 147bp DBA/2J
p 129bp JF1, PWB
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory