About   Help   FAQ
D10Mit38 Primer Detail
Primers
  • Name
    D10Mit38
  • Primer 1 Sequence
    CGATGAGCCCTAACACCAAT
  • Primer 2 Sequence
    CCTGTTACAAACTAAACCAAACCC
  • ID
    MGI:705779
  • Product Size
    149
  • Other IDs
    D10Mit38 (BROAD)
  • Note
    MIT assay: B393
    Additional information: MIT STS Marker Data Files
Genes
D10Mit38 DNA segment, Chr 10, Massachusetts Institute of Technology 38
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit38 a 160bp A/J, BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt
b 166bp B6.Cg-Lepob/+, C57BL/6J
c 178bp LP/J
d 188bp CAST/EiJ, SPRET/EiJ
e 196bp AKR/J, C3H/HeJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit38 c 149bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, PWB, SJL/J
d 145bp DBA/2J
g 169bp 129P3/J
j 173bp JF1
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit38 a larger 129P3/J
s smaller SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory