About   Help   FAQ
D19Mit88 Primer Detail
Primers
  • Name
    D19Mit88
  • Primer 1 Sequence
    AACAGTGCAACTTTGGAGGC
  • Primer 2 Sequence
    TCATTGGAACTGTCTTAACAGTGC
  • ID
    MGI:705755
  • Product Size
    148
  • Other IDs
    D19Mit88 (BROAD)
  • Note
    MIT assay: MTAR4121
    Additional information: MIT STS Marker Data Files
Genes
D19Mit88 DNA segment, Chr 19, Massachusetts Institute of Technology 88
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit88 c 144bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit88 a 136bp SPRET/EiJ
b 138bp CAST/EiJ
c 142bp A/J, AKR/J, BALB/cJ, LP/J, NON/ShiLt
d 144bp C3H/HeJ, NOD/MrkTac
e 148bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D19Mit88 c 133bp A/JOlaHsd, AKR/OlaHsd, BALB/cJ, SJL/J
d 139bp C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
g 131bp 129P3/J
j 119bp JF1
p 123bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit88 c 153bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory