About   Help   FAQ
D4Mit244 Primer Detail
Primers
  • Name
    D4Mit244
  • Primer 1 Sequence
    CAAAATATCTGACAAAAACAAGTGTG
  • Primer 2 Sequence
    GGTGTCATCACCATGATGGA
  • ID
    MGI:705733
  • Product Size
    110
  • Other IDs
    D4Mit244 (BROAD)
  • Note
    MIT assay: MTAR4125
    Additional information: MIT STS Marker Data Files
Genes
D4Mit244 DNA segment, Chr 4, Massachusetts Institute of Technology 244
Polymorphisms
J:50273 Poltorak A, et al., Blood Cells Mol Dis. 1998 Sep;24(3):340-55
Endonuclease Gene Allele Fragments Strains
D4Mit244 h not given C3H/HeJ
s not given SWR
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit244 a 112bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
b 114bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
c 116bp DBA/2J
d 130bp CAST/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit244 a 0.11kb CBA/Ca
c 0.125kb CAST/EiJ
p 0.115kb STOCK Whrnwi
w 0.125kb STOCK Whrnwi
References
J:50273 Poltorak A, et al., Genetic and physical mapping of the Lps locus: identification of the toll-4 receptor as a candidate gene in the critical region. Blood Cells Mol Dis. 1998 Sep;24(3):340-55
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory