About   Help   FAQ
D5Mit61 Primer Detail
Primers
  • Name
    D5Mit61
  • Primer 1 Sequence
    TGTGAGGGTGTTTGAGAGACA
  • Primer 2 Sequence
    AAAGCTCTGAGTTTGATACACAAA
  • ID
    MGI:705726
  • Product Size
    100
  • Other IDs
    D5Mit61 (BROAD)
  • Note
    MIT assay: B674
    Additional information: MIT STS Marker Data Files
Genes
D5Mit61 DNA segment, Chr 5, Massachusetts Institute of Technology 61
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit61 a 102bp 129X1/Sv
f 100bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit61 a 94bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
b 100bp LP/J
c 102bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NON/ShiLt
d 108bp SPRET/EiJ
e 110bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D5Mit61 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit61 c 103bp CBA/CaOlaHsd
s 99bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory