About   Help   FAQ
D7Mit57 Primer Detail
Primers
  • Name
    D7Mit57
  • Primer 1 Sequence
    TTCCCTCTAGAACTCTGACCTCC
  • Primer 2 Sequence
    AGTTCAGAGCCGAGACTAGGC
  • ID
    MGI:705711
  • Product Size
    148
  • Other IDs
    D7Mit57 (BROAD)
  • Note
    MIT assay: D515
    Additional information: MIT STS Marker Data Files
Genes
D7Mit57 DNA segment, Chr 7, Massachusetts Institute of Technology 57
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D7Mit57 b not given C57BL/6J
c 152bp C3HeB/FeJLe
f smallest FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit57 a 136bp AKR/J, CAST/EiJ, DBA/2J
b 144bp SPRET/EiJ
c 150bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
d 152bp C3H/HeJ, LP/J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory