DXMit159 Primer Detail MGI Mouse MGI:705705

DXMit159 Primer Detail

Name

DXMit159
Primer 1 Sequence

ACCTTTTCAGGAAATTACTTGGC
Primer 2 Sequence

TTTAATTGCAGTCAATGATCCG
ID

MGI:705705
Product Size

94
Other IDs

DXMit159 (BROAD)
Note

MIT assay: MT3541
Additional information: MIT STS Marker Data Files

DXMit159

DNA segment, Chr X, Massachusetts Institute of Technology 159

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit159	a	98bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	90bp	129X1/SvJ
		c	102bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit159	a	96bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	98bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J
	c	110bp	AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
	d	114bp	CAST/EiJ, SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13