About   Help   FAQ
DXMit159 Primer Detail
Primers
  • Name
    DXMit159
  • Primer 1 Sequence
    ACCTTTTCAGGAAATTACTTGGC
  • Primer 2 Sequence
    TTTAATTGCAGTCAATGATCCG
  • ID
    MGI:705705
  • Product Size
    94
  • Other IDs
    DXMit159 (BROAD)
  • Note
    MIT assay: MT3541
    Additional information: MIT STS Marker Data Files
Genes
DXMit159 DNA segment, Chr X, Massachusetts Institute of Technology 159
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit159 a 98bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 90bp 129X1/SvJ
c 102bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit159 a 96bp B6.Cg-Lepob/+, C57BL/6J
b 98bp A/J, BALB/cJ, C3H/HeJ, DBA/2J
c 110bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
d 114bp CAST/EiJ, SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory