About   Help   FAQ
DXMit153 Primer Detail
Primers
  • Name
    DXMit153
  • Primer 1 Sequence
    CAATCAAGCAGATGGAAGCA
  • Primer 2 Sequence
    AAGGACTGCCAAGAGGACAA
  • ID
    MGI:705699
  • Product Size
    143
  • Other IDs
    DXMit153 (BROAD)
  • Note
    MIT assay: MT3987
    Additional information: MIT STS Marker Data Files
Genes
DXMit153 DNA segment, Chr X, Massachusetts Institute of Technology 153
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit153 b 0.145kb B10.D2-H2d, C57BL/6
c 0.158kb B10.BR-H2k, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit153 a 130bp CAST/EiJ
b 145bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
c 154bp NON/ShiLt
d 158bp A/J, BALB/cJ
e 168bp SPRET/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory