About   Help   FAQ
D2Mit266 Primer Detail
Primers
  • Name
    D2Mit266
  • Primer 1 Sequence
    GGATCTATGCTCCATTTTAATTGC
  • Primer 2 Sequence
    TCATCTTCTGGTTTCAACATGG
  • ID
    MGI:705693
  • Product Size
    127
  • Other IDs
    D2Mit266 (BROAD)
  • Note
    MIT assay: MT2735
    Additional information: MIT STS Marker Data Files
Genes
D2Mit266 DNA segment, Chr 2, Massachusetts Institute of Technology 266
D11Mit1007 DNA segment, Chr 11, Massachusetts Institute of Technology 1007
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit266 a 130bp 129X1/Sv
f 130, 150bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit266 c 138bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit266 a 128bp B6.Cg-Lepob/+
b 130bp C57BL/6J
c 132bp BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
d 136bp A/J, AKR/J, SPRET/EiJ
e 138bp C3H/HeJ, DBA/2J
f 148bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit266 c 275bp CBA/CaOlaHsd
s 220bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory