About   Help   FAQ
D2Mit263 Primer Detail
Primers
  • Name
    D2Mit263
  • Primer 1 Sequence
    ACTGAATCATCTCTCTCCTCAGC
  • Primer 2 Sequence
    AGTTCAGTTCTTAGAACCCACAGC
  • ID
    MGI:705689
  • Product Size
    138
  • Other IDs
    D2Mit263 (BROAD)
  • Note
    MIT assay: MT2016
    Additional information: MIT STS Marker Data Files
Genes
D2Mit263 DNA segment, Chr 2, Massachusetts Institute of Technology 263
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit263 a 128bp SPRET/EiJ
b 132bp AKR/J
c 134bp A/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
d 136bp DBA/2J
e 140bp B6.Cg-Lepob/+, C57BL/6J
f 144bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit263 c 186bp CBA/CaOlaHsd
s 180bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory