D2Mit274 Primer Detail MGI Mouse MGI:705682

D2Mit274 Primer Detail

Name

D2Mit274
Primer 1 Sequence

AGGCATTGTCAAGACCAACC
Primer 2 Sequence

TACGTTTCTCAACTCATCAGTGTG
ID

MGI:705682
Product Size

129
Other IDs

D2Mit274 (BROAD)
Note

MIT assay: MT3103
Additional information: MIT STS Marker Data Files

D2Mit274

DNA segment, Chr 2, Massachusetts Institute of Technology 274

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit274	c	144bp	C3HeB/FeJLe
	D2Mit274	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit274	a	84bp	SPRET/EiJ
	b	126bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	134bp	LP/J
	d	138bp	A/J, AKR/J, BALB/cJ, DBA/2J, NOD/MrkTac
	e	140bp	NON/ShiLt
	f	144bp	C3H/HeJ, CAST/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D2Mit274	c	not given	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit274	c	142bp	CBA/CaOlaHsd
	D2Mit274	s	129bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24