About   Help   FAQ
D16Mit131 Primer Detail
Primers
  • Name
    D16Mit131
  • Primer 1 Sequence
    TGGTGGTGGTGTTGATGGTA
  • Primer 2 Sequence
    AAGACCATTTCTAATAAACAACACCC
  • ID
    MGI:705669
  • Product Size
    140
  • Other IDs
    D16Mit131 (BROAD)
  • Note
    MIT assay: MT3351
    Additional information: MIT STS Marker Data Files
Genes
D16Mit131 DNA segment, Chr 16, Massachusetts Institute of Technology 131
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D16Mit131 b smallest C57BL/6J
c 180bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit131 a 144bp B6.Cg-Lepob/+, C57BL/6J
b 168bp SPRET/EiJ
c 174bp A/J
d 176bp AKR/J
e 178bp CAST/EiJ
f 180bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
g 184bp NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D16Mit131 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit131 c 174bp CBA/CaOlaHsd
s 173bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory