D16Mit138 Primer Detail MGI Mouse MGI:705665

D16Mit138 Primer Detail

Name

D16Mit138
Primer 1 Sequence

GAAGGAAAAATCTACCAGAAGAAGC
Primer 2 Sequence

GCCTGGACACTTCTATGGCT
ID

MGI:705665
Product Size

149
Other IDs

D16Mit138 (BROAD)
Note

MIT assay: MTAR133
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 138

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit138	a	154bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	b	158bp	LP/J, NOD/MrkTac
	c	160bp	AKR/J, NON/ShiLt
	d	162bp	CAST/EiJ
	e	168bp	A/J, BALB/cJ, DBA/2J
	f	170bp	SPRET/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit138	c	larger	CBA/Kw
	D16Mit138	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24