About   Help   FAQ
D16Mit138 Primer Detail
Primers
  • Name
    D16Mit138
  • Primer 1 Sequence
    GAAGGAAAAATCTACCAGAAGAAGC
  • Primer 2 Sequence
    GCCTGGACACTTCTATGGCT
  • ID
    MGI:705665
  • Product Size
    149
  • Other IDs
    D16Mit138 (BROAD)
  • Note
    MIT assay: MTAR133
    Additional information: MIT STS Marker Data Files
Genes
D16Mit138 DNA segment, Chr 16, Massachusetts Institute of Technology 138
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit138 a 154bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
b 158bp LP/J, NOD/MrkTac
c 160bp AKR/J, NON/ShiLt
d 162bp CAST/EiJ
e 168bp A/J, BALB/cJ, DBA/2J
f 170bp SPRET/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D16Mit138 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory