About   Help   FAQ
D8Mit120 Primer Detail
Primers
  • Name
    D8Mit120
  • Primer 1 Sequence
    GGGACATCGCCATAGAACAT
  • Primer 2 Sequence
    AGATGCTGAAGGGAAATCAGA
  • ID
    MGI:705658
  • Product Size
    130
  • Other IDs
    D8Mit120 (BROAD)
  • Note
    MIT assay: MPC1259
    Additional information: MIT STS Marker Data Files
Genes
D8Mit120 DNA segment, Chr 8, Massachusetts Institute of Technology 120
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit120 a 118bp CAST/EiJ
b 120bp NON/ShiLt
c 130bp LP/J
d 132bp BALB/cJ
e 134bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
f 140bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit120 c 127bp CBA/CaOlaHsd
s 119bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory