About   Help   FAQ
D8Mit121 Primer Detail
Primers
  • Name
    D8Mit121
  • Primer 1 Sequence
    CGGTCAATCCCGAGTTTG
  • Primer 2 Sequence
    CAAGGCTGTCAGTCAGTGTAGG
  • ID
    MGI:705657
  • Product Size
    256
  • Other IDs
    D8Mit121 (BROAD)
  • Note
    MIT assay: D687
    Additional information: MIT STS Marker Data Files
Genes
D8Mit121 DNA segment, Chr 8, Massachusetts Institute of Technology 121
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit121 a 242bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 230bp 129X1/SvJ
c 250bp CD-1
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D8Mit121 a 256bp AKR/OlaHsd, C3H/HeJ
c 224bp BALB/cJ, JF1
d 254bp C57BL/6JOlaHsd, C57BL/10, DBA/2J, SJL/J
g 244bp 129P3/J
p 228bp PWB
w 222bp A/JOlaHsd
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D8Mit121 c 155bp CBA/CaOlaHsd
s 157bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory