About   Help   FAQ
D2Mit91 Primer Detail
Primers
  • Name
    D2Mit91
  • Primer 1 Sequence
    CCATTCTTTGCTTCTGTCTCTG
  • Primer 2 Sequence
    CCACCTTTGCAAAATACATGC
  • ID
    MGI:705630
  • Product Size
    178
  • Other IDs
    D2Mit91 (BROAD)
  • Note
    MIT assay: MPC1739
    Additional information: MIT STS Marker Data Files
Genes
D2Mit91 DNA segment, Chr 2, Massachusetts Institute of Technology 91
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit91 a 154bp SPRET/EiJ
b 162bp LP/J
c 174bp C3H/HeJ
d 180bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
e 182bp AKR/J
f 192bp CAST/EiJ
g 194bp DBA/2J, NOD/MrkTac, NON/ShiLt
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D2Mit91 c lower CBA/Kw
k upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory