About   Help   FAQ
D10Mit35 Primer Detail
Primers
  • Name
    D10Mit35
  • Primer 1 Sequence
    GTGCTGCTTCACTGTTTGGA
  • Primer 2 Sequence
    CAAGCAAGGTAAATTGGAAAGG
  • ID
    MGI:705597
  • Product Size
    225
  • Other IDs
    D10Mit35 (BROAD)
  • Note
    MIT assay: B274
    Additional information: MIT STS Marker Data Files
Genes
D10Mit35a DNA segment, Chr 10, Massachusetts Institute of Technology 35a
D10Mit35b DNA segment, Chr 10, Massachusetts Institute of Technology 35b
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit35a m 250bp MOLF/EiJ
s 236bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit35a a 210bp NON/ShiLt
b 226bp B6.Cg-Lepob/+
c 228bp AKR/J, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
d 236bp A/J
e 240bp BALB/cJ, LP/J
f 242bp SPRET/EiJ
g 250bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D10Mit35a a 242bp BALB/cW
b 236bp A.CA/W
c 225bp 129/SvW, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory