About   Help   FAQ
D10Mit31 Primer Detail
Primers
  • Name
    D10Mit31
  • Primer 1 Sequence
    CATAAGGAGCACAGGCATGA
  • Primer 2 Sequence
    CCCTCTACGTGCATGCTGTA
  • ID
    MGI:705592
  • Product Size
    150
  • Other IDs
    D10Mit31 (BROAD)
  • Note
    MIT assay: A786
    Additional information: MIT STS Marker Data Files
Genes
D10Mit31 DNA segment, Chr 10, Massachusetts Institute of Technology 31
Polymorphisms
J:45743 Zobeley E, et al., Genomics. 1998 Jun 1;50(2):260-6
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit31 b 152bp C57BL/6J
c 134bp CASA/RkJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit31 a 134bp CAST/EiJ
b 152bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
c 154bp A/J, AKR/J, BALB/cJ, C3H/HeJ, NON/ShiLt
d 180bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D10Mit31 a 156bp AKR/OlaHsd
b 148bp C57BL/6JOlaHsd, C57BL/10, JF1
d 154bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, SJL/J
p 138bp PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D10Mit31 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D10Mit31 c 151bp CBA/CaOlaHsd
s 154bp SWR/OlaHsd
References
J:45743 Zobeley E, et al., Fine genetic and comparative mapping of the deafness mutation Ames waltzer on mouse chromosome 10. Genomics. 1998 Jun 1;50(2):260-6
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory