About   Help   FAQ
D4Mit25 Primer Detail
Primers
  • Name
    D4Mit25
  • Primer 1 Sequence
    ATGGTGCAACTCACAAAGTCC
  • Primer 2 Sequence
    CACAGATGGAAAGAGTGTCTTCC
  • ID
    MGI:705589
  • Product Size
    208
  • Other IDs
    D4Mit25 (BROAD)
  • Note
    MIT assay: B169
    Additional information: MIT STS Marker Data Files
Genes
D4Mit25 DNA segment, Chr 4, Massachusetts Institute of Technology 25
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit25 a 210bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 222bp SPRET/EiJ
c 224bp CAST/EiJ
J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9
Endonuclease Gene Allele Fragments Strains
D4Mit25 c 0.25kb CAST/EiJ
p 0.215kb STOCK Whrnwi
w 0.215kb STOCK Whrnwi
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory