About   Help   FAQ
D4Mit26 Primer Detail
Primers
  • Name
    D4Mit26
  • Primer 1 Sequence
    CTGATGGTAGCAGAATCAGGC
  • Primer 2 Sequence
    CGGTAGTTTTTCAAAGATCGTG
  • ID
    MGI:705588
  • Product Size
    209
  • Note
    MIT assay: J1
Genes
D4Mit26 DNA segment, Chr 4, Massachusetts Institute of Technology 26
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit26 c 176bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit26 a 170bp AKR/J
b 174bp BALB/cJ
c 176bp C3H/HeJ
d 186bp NON/ShiLt
e 194bp LP/J, NOD/MrkTac
f 202bp A/J, C57BL/6J, DBA/2J
g 210bp B6.Cg-Lepob/+
h 214bp SPRET/EiJ
i 222bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit26 c 211bp CBA/CaOlaHsd
s 180bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory