About   Help   FAQ
D4Mit27 Primer Detail
Primers
  • Name
    D4Mit27
  • Primer 1 Sequence
    GCACGGTAGTTTTTCCAGGA
  • Primer 2 Sequence
    TGGTGGGCAGGCAATAGT
  • ID
    MGI:705587
  • Product Size
    150
  • Other IDs
    D4Mit27 (BROAD)
  • Note
    MIT assay: P87
    Additional information: MIT STS Marker Data Files
Genes
D4Mit27 DNA segment, Chr 4, Massachusetts Institute of Technology 27
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit27 c 118bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit27 a 118bp BALB/cJ, C3H/HeJ
b 120bp AKR/J
c 128bp NON/ShiLt
d 138bp LP/J, NOD/MrkTac
e 150bp A/J, B6.Cg-Lepob/+, C57BL/6J
f 152bp DBA/2J
g 158bp SPRET/EiJ
h 164bp CAST/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory