D19Mit128 Primer Detail MGI Mouse MGI:705573

D19Mit128 Primer Detail

Name

D19Mit128
Primer 1 Sequence

GGCAGGAGAATGTATTCAGAAA
Primer 2 Sequence

TCCTCCAACCTGCTTCCTC
ID

MGI:705573
Product Size

124
Other IDs

D19Mit128 (BROAD)
Note

MIT assay: MTH1463
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 19, Massachusetts Institute of Technology 128

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit128	a	109bp	CAST/EiJ
	b	113bp	NOD/MrkTac
	c	115bp	BALB/cJ
	d	123bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	127bp	SPRET/EiJ
	f	141bp	A/J, AKR/J
	g	145bp	C3H/HeJ, NON/ShiLt
	h	147bp	DBA/2J, LP/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit128	c	larger	CBA/Kw
	D19Mit128	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24