About   Help   FAQ
D19Mit128 Primer Detail
Primers
  • Name
    D19Mit128
  • Primer 1 Sequence
    GGCAGGAGAATGTATTCAGAAA
  • Primer 2 Sequence
    TCCTCCAACCTGCTTCCTC
  • ID
    MGI:705573
  • Product Size
    124
  • Other IDs
    D19Mit128 (BROAD)
  • Note
    MIT assay: MTH1463
    Additional information: MIT STS Marker Data Files
Genes
D19Mit128 DNA Segment, Chr 19, Massachusetts Institute of Technology 128
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit128 a 109bp CAST/EiJ
b 113bp NOD/MrkTac
c 115bp BALB/cJ
d 123bp B6.Cg-Lepob/+, C57BL/6J
e 127bp SPRET/EiJ
f 141bp A/J, AKR/J
g 145bp C3H/HeJ, NON/ShiLt
h 147bp DBA/2J, LP/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D19Mit128 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory