About   Help   FAQ
D1Mit415 Primer Detail
Primers
  • Name
    D1Mit415
  • Primer 1 Sequence
    TTGGCACATGCCTACAACTC
  • Primer 2 Sequence
    AGAACACCATATATTGTGCCCC
  • ID
    MGI:705566
  • Product Size
    155
  • Other IDs
    D1Mit415 (BROAD)
  • Note
    MIT assay: MTH794
    Additional information: MIT STS Marker Data Files
Genes
D1Mit415 DNA segment, Chr 1, Massachusetts Institute of Technology 415
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit415 a 105bp A/J, C3H/HeJ, LP/J, NON/ShiLt
b 107bp DBA/2J
c 111bp CAST/EiJ
d 149bp SPRET/EiJ
e 157bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D1Mit415 l smaller LG/J
s larger SM/J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D1Mit415 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory