About   Help   FAQ
D1Mit414 Primer Detail
Primers
  • Name
    D1Mit414
  • Primer 1 Sequence
    TTCCCTTTTACTGAATTCATTATTTG
  • Primer 2 Sequence
    TCCCAGAGGTCCTGGTACAC
  • ID
    MGI:705565
  • Product Size
    108
  • Other IDs
    D1Mit414 (BROAD)
  • Note
    MIT assay: MTH798
    Additional information: MIT STS Marker Data Files
Genes
D1Mit414 DNA segment, Chr 1, Massachusetts Institute of Technology 414
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit414 a >0.130kb BALB.K-H2k
b 0.110kb B10.BR-H2k, B10.D2-H2d, C57BL/6
c 0.130kb BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit414 a 110bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
b 114bp SPRET/EiJ
c 128bp NOD/MrkTac
d 130bp BALB/cJ
e 132bp NON/ShiLt
f 138bp CAST/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory