About   Help   FAQ
D2Mit300 Primer Detail
Primers
  • Name
    D2Mit300
  • Primer 1 Sequence
    TGTGCACACTGTGGTCATACA
  • Primer 2 Sequence
    TTAGGCTATTTCTACCTGTGTAGAACC
  • ID
    MGI:705544
  • Product Size
    106
  • Other IDs
    D2Mit300 (BROAD)
  • Note
    MIT assay: MTAR105
    Additional information: MIT STS Marker Data Files
Genes
D2Mit300 DNA segment, Chr 2, Massachusetts Institute of Technology 300
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit300 a 106bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
b 108bp B6.Cg-Lepob/+, C57BL/6J
c 124bp A/J
d 130bp CAST/EiJ
e 132bp NON/ShiLt
f 196bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit300 c 119bp CBA/CaOlaHsd
s 101bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory