About   Help   FAQ
D1Mit185 Primer Detail
Primers
  • Name
    D1Mit185
  • Primer 1 Sequence
    CCACCAACAGACAGAGCAAA
  • Primer 2 Sequence
    TTTCTTCTCAATAAACACACACATACA
  • ID
    MGI:705536
  • Product Size
    144
  • Other IDs
    D1Mit185 (BROAD)
  • Note
    MIT assay: MPC2595
    Additional information: MIT STS Marker Data Files
Genes
D1Mit185 DNA segment, Chr 1, Massachusetts Institute of Technology 185
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit185 a 136bp SPRET/EiJ
b 146bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NON/ShiLt
c 148bp DBA/2J, LP/J
d 150bp NOD/MrkTac
e 152bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit185 c 146bp CBA/CaOlaHsd
s 150bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory