About   Help   FAQ
D3Mit163 Primer Detail
Primers
  • Name
    D3Mit163
  • Primer 1 Sequence
    TGGATACATACATATACATGGAAATGC
  • Primer 2 Sequence
    TTTCTCCAGACCCATGAACC
  • ID
    MGI:705534
  • Product Size
    143
  • Other IDs
    D3Mit163 (BROAD)
  • Note
    MIT assay: MT1260
    Additional information: MIT STS Marker Data Files
Genes
D3Mit163 DNA segment, Chr 3, Massachusetts Institute of Technology 163
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit163 a 125bp SPRET/EiJ
b 141bp CAST/EiJ
c 143bp B6.Cg-Lepob/+
d 146bp C57BL/6J
e 147bp A/J, BALB/cJ, C3H/HeJ
f 149bp AKR/J, DBA/2J, LP/J, NOD/MrkTac
g 151bp NON/ShiLt
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit163 a larger 129P3/J
s smaller SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory