About   Help   FAQ
D17Mit167 Primer Detail
Primers
  • Name
    D17Mit167
  • Primer 1 Sequence
    AATTAAGTATACTTGCTGGTGTGTGC
  • Primer 2 Sequence
    TCTTCTGTGACTATCTCTGATGCC
  • ID
    MGI:705498
  • Product Size
    122
  • Other IDs
    D17Mit167 (BROAD)
  • Note
    MIT assay: MTAR103
    Additional information: MIT STS Marker Data Files
Genes
D17Mit167 DNA segment, Chr 17, Massachusetts Institute of Technology 167
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit167 b 128bp C57BL/6J
s 124bp 129X1/SvJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit167 a 124bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
b 126bp NON/ShiLt
c 128bp B6.Cg-Lepob/+, C57BL/6J
d 130bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit167 c 135bp CBA/CaOlaHsd
s 133bp SWR/OlaHsd
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory