D17Mit165 Primer Detail MGI Mouse MGI:705496

D17Mit165 Primer Detail

Name

D17Mit165
Primer 1 Sequence

ACTTTAGATGATTGCAATATTTGTGT
Primer 2 Sequence

TCACCTTTTATCTTCTATATGCATGC
ID

MGI:705496
Product Size

124
Other IDs

D17Mit165 (BROAD)
Note

MIT assay: MTAR125
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 165

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit165	b	126bp	C57BL/6J
Not Specified	D17Mit165	s	124bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit165	a	118bp	SPRET/EiJ
	b	124bp	BALB/cJ, DBA/2J, LP/J, NON/ShiLt
	c	126bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	d	128bp	CAST/EiJ

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13