About   Help   FAQ
D17Mit164 Primer Detail
Primers
  • Name
    D17Mit164
  • Primer 1 Sequence
    AGGCCCTAACATGTAGCAGG
  • Primer 2 Sequence
    TATTATTGAGACTGTGGTTGTTGTTG
  • ID
    MGI:705495
  • Product Size
    133
  • Other IDs
    D17Mit164 (BROAD)
  • Note
    MIT assay: MT3318
    Additional information: MIT STS Marker Data Files
Genes
D17Mit164 DNA segment, Chr 17, Massachusetts Institute of Technology 164
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit164 a <0.126kb B10.BR-H2k
b 0.136kb B10.D2-H2d, C57BL/6
c 0.126kb BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit164 b 136bp C57BL/6J
c 126bp BALB/cJ
s 123bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit164 a 96bp NOD/MrkTac
b 110bp SPRET/EiJ
c 120bp NON/ShiLt
d 126bp A/J, AKR/J, BALB/cJ, C3H/HeJ
e 136bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
f 144bp CAST/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit164 a smaller 129P3/J
s larger SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit164 a 136bp 129/SvW, A.CA/W, C57BL/6W, C57BL/10W, DBA/2W
b 126bp AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory