About   Help   FAQ
D3Mit55 Primer Detail
Primers
  • Name
    D3Mit55
  • Primer 1 Sequence
    CTGGGACCACCAGTAGTACCA
  • Primer 2 Sequence
    TCAGGACTGCAACTGAGGC
  • ID
    MGI:705489
  • Product Size
    139
  • Other IDs
    D3Mit55 (BROAD)
  • Note
    MIT assay: B536
    Additional information: MIT STS Marker Data Files
Genes
D3Mit55 DNA segment, Chr 3, Massachusetts Institute of Technology 55
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit55 b 0.139kb B10.BR-H2k, C57BL/6
c 0.138kb B10.D2-H2d, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit55 a 116bp SPRET/EiJ
b 134bp NON/ShiLt
c 138bp AKR/J, BALB/cJ, CAST/EiJ, DBA/2J
d 139bp C57BL/6J, LP/J, NOD/MrkTac
e 144bp A/J, C3H/HeJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory